Różnicowanie fenotypowe i genotypowe drożdży z rodzajuCandidaizolowanych z kału zwierząt mięsożernych (psów i kotów)

Różnicowanie fenotypowe i genotypowe drożdży z rodzaju Candida izolowanych z kału zwierząt mięsożernych (psów i kotów).

Zakład Mykologii1, Zakład Parazytologii i Inwazjologii2, Katedra Nauk Przedklinicznych, Szkoła Główna Gospodarstwa Wiejskiego, ul. Ciszewskiego 8, 02-786 Warszawa.

Altrych Paulina1 Krutkiewicz Alicja1 Klockiewicz Maciej2 Dworecka-Kaszak Bożena1.

Wstęp Grzyby z rodzaju Candida sp. mogą występować u osobników zdrowych jako składnik stałej, endogennej bioty, zasiedlając głównie błony śluzowe organizmu, w tym również przewodu pokarmowego. Wśród komensalnych gatunków znajdują się także potencjalnie chorobotwórcze C.albicans, C.parapsilosis czy C.tropicalis. Obok tradycyjnych metod fenotypowego różnicowania gatunków stosuje się coraz bardziej powszechne metody oparte o różnice w genomie. Najczęściej sekwencjonowane obecnie fragmenty DNA grzybów to Regiony ITS (Internal Transcribed Spacer), charakteryzujące się dużą zmiennością wewnątrzgatunkową i stanowiące podstawę systematyki molekularnej na poziomie gatunku.

Materiał i metody Próbki kału pozyskiwano od psów i kotów. Z każdej próbki wykonywano preparat bezpośredni celem obserwacji obecności komórek drożdżopodobnych oraz wykonywano posiew na podłoże mykologiczne Sabouraud, inkubowano w temp. 30°C przez 72 godziny.

Hodowle oceniano na podstawie makroskopowych cech kolonii oraz mikroskopowej morfologii blastospor. Wykonywano test filamentacji, wynik dodatni uważano za przynależność do gatunku C.albicans. Identyfikację fenotypową przeprowadzono na podstawie testu API CANDIDA (bioMerieux). Przy użyciu zestawu do izolacji DNA z drożdży Genomic Mini AX YEAST wyizolowano DNA ze wszystkich szczepów o potwierdzonej przynależności do z rodzaju Candida. Stosując uniwersalne dla grzybów startery ITS1 – 5’ TCCGTAGGTGAACCTGCGG 3’ ITS4 – 5’ TCCTCCGCTTATTGATATGC 3’ przeprowadzono reakcję amplifikacji. Uzyskano produkt zawierający region ITS1, gen rDNA 5,8S oraz ITS2, który wizualizowano przeprowadzając elektroforezę w 0,8% żelu agarozowym. Porównywano wielkość uzyskanych amplikonów w obrębie jednego gatunku, jak również analizowano różnice w wielkości uzyskanego produktu w zależności od gatunku, z którego pochodziło DNA. Przeprowadzono trawienie uzyskanych produktów reakcji amplifikacji celem rozróżnienia poszczególnych gatunków.

Do analizy restrykcyjnej użyto enzymów DdeI i HpaII dobranych na podstawie analizy sekwencji nukleotydów. Produkty trawienia rozdzielono elektroforetycznie i przeanalizowano różnice we wzorach prążków.

Wyniki Przebadano 723 próbki kału, z czego 348(48%) pochodziło od psów, a 375(52%) od kotów. Z 238(33%) próbek wyizolowano szczepy wstępnie zakwalifikowane do rodzaju Candida sp. Na podstawie cech fenotypowych wykazano obecność innych grzybów drożdżopodobnych – Malassezia sp.5(0,7%), Rhodotorulla sp.47(6,5%) oraz Geotrichum sp.41(5,7%) Na podstawie testów API CANDIDA zidentyfikowano szczepy z rodzaju Candida sp. 128(85,3%): C.albicans 71(47,3%), C.parapsilosis 14(9,3%), C.krusei 12(8%), C.glabrata 5(3,3%), C.tropicalis 3(2%), C.kefyr 3(2%), C.lusitaniae 2(1,3%), C.non-albicans 7(4,6%), C.krusei/parapsilosis/Geotrichum 3(2%), C.lusitaniae/tropicalis/famata 2(1,3%), C.famata/glabrata 2(1,3%), C.famata/guillermondi 1(0,6%), oraz z gatunków Saccharomyces cerevisiae 16(10,6%), Trichosporon spp. 5(3%), Cryptococcus neoformans 1(0,6%). Wyizolowano DNA ze wszystkich 128 szczepów i po przeprowadzeniu reakcji amplifikacji z użyciem odpowiednich starterów analizowano różnice w wielkości uzyskanych produktów. Przeprowadzona analiza restrykcyjna umożliwiła różnicowanie gatunków na podstawie analizy wielkości prążków. Na podstawie wielkości amplikonu będącego produktem reakcji PCR z użyciem uniwersalnych starterów ITS1 i ITS4 możemy jednoznacznie zidentyfikować 3 gatunki: C.glabrata (881pz), C.kefyr(721pz), C.lusitaniae(341pz), wzory prążków należących do poszczególnych izolatów z gatunków C.albicans(536pz), C.krusei(509pz), C.parapsilosis(546pz), C.tropicalis(554pz) wykazują minimalne różnice– co obrazuje ryc.1. Jednakże analiza restrykcyjna z użyciem odpowiednich enzymów pozwala na różnicowanie gatunkowe. Po przeprowadzeniu trawienia z użyciem enzymów DdeI i HpaII uzyskano prążki o wielkościach: C.albicans (297pz,121pz,118pz), C.krusei (260pz,249pz), C.parapsilosis (546pz), C.glabrata (465pz,320pz,51pz,45pz), C.tropicalis (367pz,118pz,69pz), C.lusitaniae (242pz,98 pz), C.kefyr (549pz,172pz) – co obrazuje ryc.2. Wśród zebranych 3 izolatów
zakwalifikowanych do gatunku C.famata ustalonego na podstawie testu API CANDIDA, zaobserwowano różnice w wielkość fragmentu zawierającego region ITS1, gen rDNA 5,8S oraz ITS2, po zsekwencjonowaniu analizowanego fragmentu zakwalifikowano dwa szczepy do gatunku C.lusitaniae, jeden do gatunku C.lipolityca co wskazuje na małą przydatność testu API CANDIDA do różnicowania tego gatunku.

Wnioski:

  • Grzyby z rodzaju Candida sp. mogą występować w kale psów i kotów nie wykazujących objawów klinicznych ze strony przewodu pokarmowego.
  • Najbardziej rozpowszechnionym gatunkiem jest C.albicans.
  • Fenotypowa Klasyfikacja grzybów z rodzaju Candida nie zawsze jest zgodna z identyfikacją genotypową.
    Roznicowanie fenotypowe

    Roznicowanie fenotypowe

Spaying is an important part of being a responsible pet owner. It helps keep the number of pets down and is very good for the health of female dogs and...

Expert Veterinary Care, Now Delivered to Your Door

At Modern Vet, we understand that not every pet is comfortable traveling to the clinic—and not...

What is Hydrotherapy for Pets?
At Modern Vet we offer hydrotherapy for your pet through using an underwater treadmill. The underwater treadmill consists...

Modern Vet, in partnership with Blue Sky Pet Relocation, proudly offers a comprehensive and personalized pet travel service tailored to the unique needs...

We provide a complete evaluation of all organ functions during your pet’s visit to Modern Vet. We examine for the following conditions:

Dental...

A pet needs all the affection and attention you can provide. Health care is a significant component of their daily routine. Vaccinating them promptly is...

Like emergency hospitals for people, Modern Vet provides 24 hour emergency pet care, any day of the year, even on holidays. If you think to yourself that...

SPAY & NEUTER
Your Reliable Partner in Caring for Your Pet’s Health
One of the most responsible things a pet owner can do is to spay or neuter...

At ModernVet, we are proud to offer advanced ophthalmology services, dedicated to the eye health of your pets. Our state-of-the-art clinic is equipped...

Veterinary orthopaedics focuses on the treatment of musculoskeletal problems in pets.  Joints, soft tissue, bones, muscle, ligaments, and tendons are all...

DENTAL CARE FOR PETS
If you have a pet, it’s essential to know that they can have dental problems. Your dog or cat may need a checkup from their...

We at Modern Vet Hospital provide veterinary physiotherapy and rehabilitation services that are created to help your pet recover as quickly as possible...

Our pets are our life partners, and we want them to be happy and healthy. We know you don't have the time to spend on your pet. That's why we...

Ten thousand years ago when humans first began domesticating animals, they fell sick in detention and also due to the ailments of old age. In order to...

Feeding your pets high quality food gives them a chance at a longer and healthier life. Like humans, pets also require essential vitamins, minerals, and...

In Dubai, our unique Pet Taxi service is tailored exclusively for our furry friends, ensuring they travel directly from and to our clinics with ease and...

Skin-related issues are not limited to human beings and can plague animals too. Much like their owners, pets should also have regular visits to the...

The Modern Vet Hospital is the leading pet charity in Dubai, working closely with many animal welfare organizations to provide price concessions for TNR....

Veterinary neurology is the branch of medicine that studies and treats the brain, spinal cord, muscles, and nervous system in pets. Epilepsy, Meningitis,...

ModernVet Clinic is renowned as the only cardiology-focused veterinary hospital in your region. When searching for a 'veterinary cardiologist near...

At ModernVet, we're committed to enhancing the wellbeing of your canine companions through our specialized dog spay and neuter services....

At ModernVet, we specialize in providing top-notch cat spaying and neutering services, ensuring the best care for your feline companions. Recognizing the...

Vaccination is the process of immunization, which enhances an animal's immune system and helps it fight diseases. Vaccines are made from killed or...

You must know the pros and cons of vaccinating your cat if you're a pet owner. While some cats can be healthy without vaccination, others may not...

The modern Vet Clinic is a full-service animal hospital that provides comprehensive veterinary care for dogs in Dubai. From preventative treatment and...

At Modern Vet, we solely provide veterinarian care, boarding, and grooming for cats. Modern veterinary clinics are committed to delivering superior care...